©2023 International Society of Arboriculture 172 reaction (PCR) conditions are summarized in Table 1. PCR products were purified using ExoSAP-IT™ (Affymetrix, Inc., Santa Clara, CA, USA) according to manufacturer’s instructions, and both strands were sequenced at the Genomics Shared Resource at The Ohio State University Comprehensive Cancer Center using an ABI Prism 3730 DNA analyzer (Applied Biosystems, Foster City, CA, USA). Sequences were assembled, trimmed, and aligned in MEGA X v.10.2.5 (Kumar et al. 2018) and single nucleotide polymorphisms (SNPs) were identified. After manual inspection of the chromatograph peaks, consensus sequences were deposited in the NCBI GenBank database (see Results for accession numbers). Pathogenicity Tests D. eres has never been reported on P. occidentalis, hence, pathogenicity tests were conducted with select isolates of D. eres retrieved from twig cankers. On 2021 June 8, 9 wildtype and 19 ‘Davis’ potted trees from the same populations that were used for the field trials, were subject to artificial inoculations inside a tetracycline hydrochloride (Fisher Scientific, Fair Lawn, NJ, USA). Plates were incubated at 25 °C under constant fluorescent white light for up to 10 days. Plates were checked daily, and any observed fungal growth was sub-cultured onto new PDA. Single spore cultures of each isolate were obtained by streaking spores onto new PDA plates and selecting one iso- lated germinating spore. Total genomic DNA was extracted from pure cul- tures of isolates grown on PDA at 25 °C for 7 days using a Chelex extraction method (Walsh et al. 1991). All isolates were first characterized to genus by amplifying the internal transcribed spacer (ITS) (White et al. 1990) region 1 (complete) and 2 (partial) and elongation factor (EF1-α)(Carbone and Kohn 1999) gene fragments. Subsequently, to identify isolates down to species, the calmodulin (CAL)(Carbone and Kohn 1999) locus was used to identify Apiognomo- nia species, while DNA-(apurinic or apyrimidinic site) lyase (Apn2)(Udayanga et al. 2014) and tubulin (TUB)(Glass and Donaldson 1995) were used for Diaporthe sp. All primers and polymerase chain Farinas Simmt et al: Field Resistance of American Sycamore ‘Davis’ to Canker Pathogens Table 1. Amplified loci, primers, polymerase chain reaction (PCR) conditions, and references for the molecular characterization of Apignomonia platani and Diaporthe eres isolates from this study. Apn2 (DNA-[apurinic or apyrimidinic site] lyase); TUB (β-tubulin); EF1-α (elongation factor); ITS (internal transcribed spacer); CAL (calmodulin). Locus Primers PCR conditions Product size (base pairs) References Apn2 apn2fw2: GCMATGTTYGAMATYCTGGAG apn2rw2: CTTGGTCTCCCAGCAGGTGAAC 95 °C 1 min; (95 °C 30 s, 54 °C 30 s, 72 °C 1 min) × 40 cycles; 72 °C 10 min 700 Adapted from Udayanga et al. 2014 TUB Bt2a: GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC 94 °C 2 min; (94 °C 30 s, 55 °C 1 min, 72 °C 1 min) × 40 cycles; 72 °C 3 min 450 Adapted from Glass et al. 1995 EF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG EF1-986R: TACTTGAAGGAACCCTTACC 95 °C 1 min; (94 °C 30 s, 58 °C 50 s, 72 °C 1 min) × 35 cycles; 72 °C 10 min 350 Adapted from Carbone and Kohn 1999 ITS ITS4: TCCTCCGCTTATTGATATGC ITS5: GGAAGTAAAAGTCGTAACAAGG 94 °C 2 min; (94 °C 30 s, 58 °C 1 min, 72 °C 1 min) × 40 cycles; 72 °C 3 min 500 Adapted from White et al. 1990 CAL CAL-228F: GAGTTCAAGGAGGCCTTCTCCC CAL-737R: CATCTTTCTGGCCATCATGG 94 °C 2 min; (94 °C 30 s, 58 °C 1 min, 72 °C 1 min) × 35 cycles; 72 °C 3 min 500 Adapted from Carbone and Kohn 1999
July 2023
| Title Name |
Pages |
Delete |
Url |
| Empty |
Search Text Block
Page #page_num
#doc_title
Hi $receivername|$receiveremail,
$sendername|$senderemail wrote these comments for you:
$message
$sendername|$senderemail would like for you to view the following digital edition.
Please click on the page below to be directed to the digital edition:
$thumbnail$pagenum
$link$pagenum
Your form submission was a success. You will be contacted by Washington Gas with follow-up information regarding your request.
This process might take longer please wait
